Single Nucleotide Polymorphism workshop, Ljubljana

From Hackteria Wiki
Revision as of 12:03, 11 April 2013 by Dusjagr (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search

SNP workshop.jpg


Dodatni material


A. Postopek za izolacijo DNA iz sline

1. Saliva collection

a. Prior to collection of saliva samples, the donor should rinse their mouth with a few millilitres of water for 10 seconds in order to remove any food particles that may be present. If food particles are present they may cause clogging of the column.

b. Ten minutes after rinsing collect saliva by spitting into a sterile collection tube or vial. The amount of saliva collected should be at least 100 µL but not more than 2 mL.

c. Transfer 250 µL of liquid saliva to a sterile microcentrifuge tube.

d. Add 250 µL Lysis Solution, and mix by vortexing.

e. Incubate the saliva mixture at 55°C for a minimum of 1 hour. Mix the mixture by inversion for a few seconds after the incubation.

f. Add 10 µL of Proteinase K. Mix by vortexing and incubate at 55°C for 20 minutes.

g. Add 250 µL of Binding Solution the saliva sample. Mix by vortexing.

h. Add 750 µL of 96 % Ethanol and mix by vortexing for a few seconds.


2. Sample Binding to Column

a. Assemble a column with one of the provided collection tubes.

b. Apply up to 760 µL of the lysate from Step 1 to the column and centrifuge for 1 minute at

8,000 x g (~8,000 RPM). Note: Ensure the entire sample has passed through into the collection tube by inspecting the column. If the entire sample volume has not passed, spin for additional 1 minute.

c. Discard the flowthrough and reassemble the spin column with its collection tube.

d. Repeat Steps 2b and 2c to complete the binding of the lysate to the column.


3. Column Wash

a. Apply 500 µL of Wash Solution I to the column and centrifuge for 1 minute at 8,000 x g (~8,000 RPM). Discard the flowthrough and reassemble the spin column with its collection tube.

Note: Ensure the entire wash solution has passed through into the collection tube by inspecting the column. If the entire wash volume has not passed, spin for an additional minute.

b. Apply 500 µL of Wash Solution II to the column and centrifuge for 1 minute at 14,000 x g (~14,000 RPM). Discard the flowthrough and reassemble the spin column with its collection tube.

c. Spin the column for 2 minutes at 14,000 x g (~14,000 RPM) in order to thoroughly dry the column. Discard the collection tube.

4. DNA Elution

a. Place the column into a fresh 1.7 mL Elution tube provided with the kit.

b. Add 50 µL of Elution Buffer to the column. Incubate for 1 minute.

c. Centrifuge for 1 minutes at 14,000 x g (~14,000 RPM).


B. Določanje OXTR polimorfizma (šifra rs53576) na osnovi genomske DNA

Zaporedje začetnih oligonukleotidov, ki smo jih uporabili pri reakciji PCR:

OXTR_F GCCCACCATGCTCTCCACATC OXTR_R GCTGGACTCAGGAGGAATAGGGAC

Shematski prikaz gena OXTR z označenim mestom, kjer se nahaja polimorfizem in prijemališči začetnih oligonukleotidov. Kakšne velikosti bo odsek DNA, ki ga bomo pomnožili z reakcijo PCR?


Več podatkov o OXTR SNP najdete na spletni strani: http://www.snpedia.com/index.php/Rs53576


C. Dodatno branje

Geni in kultura: različni vplivi OXTR gena na družabnost pri Američanih in Korejcih

Obstajajo dobre in slabe gledališke predstave; scenarij zgolj en vidik njihove produkcije. Tako imajo lahko enake besede zelo različen pomen glede na pristop režiserja, sposobnost igralcev in scenografijo. Enako velja za naše gene in okolico. V primerih, kjer geni vplivajo na naše obnašanje, lahko enako zaporedje DNA privede do različnih posledic, ki so odvisne od okoliščin. Ravno tako, kot produkcija izoblikuje predstavo, tako okolje in kultura spreminjata učinke določenih genov.

Heejung Kim iz Kalifornijske univerze je odkrila izvrsten primer teh učinkov pri preučevanju gena OXTRC (oksitocinski receptor). Dotični gen ustvari »ležišče« za hormon oksitocin, ki vpliva na najrazličnejša čustva in obnašanje v družbi , od zaupanja, spolne vzburjenosti do sočutja.

Kim je preučevala specifične inačice OXTR gena, katerega nosilci naj bi bili bolj družabni in čutni. Vendar je povezava med določenim genom in obnašanjem je odvisna od kulture; najdemo jo pri Američanih, ki so nagnjeni k iskanju utehe v težkih trenutkih, ne pa tudi v korejskih kulturah, kjer je takšna podpora družbeno manj sprejemljiva. Kultura torej določa oder, na katerem se OXTR gen izraža.

OXTRC je različen pri vsakem posamezniku in postavitev DNA »črk« (nukleotidov) v določeno zaporedje lahko vpliva na način kako se obnašamo. Glede na predhodne študije so osebe s črko G na specifičnem mestu praviloma bolj čutni starši, bolj sočutni in manj osamljeni kot tisti s črko A na tem specifičnem mestu. Ampak večina teh študij je bila izvedena na beli, zahodni populaciji in tako ta vzorec ni reprezentativen, vkolikor vzamemo v obzir svetovno populacijo.

Kim se je zato odločila razširiti vzorec in je primerjala 134 korejskih študentov s 140 ameriškmi. Najprej je preko vprašalnika določila raven stresa, kateremu je bil posameznik v tistem trenutku življenja izpostavljen in njihovo zmožnost premagovanja le-tega. Kot pri predhodnih raziskavah, je tudi Kim prišla do ugotovitve, da so Korejci manj nagnjeni k iskanju utehe kot Američani in da obenem, če se že za to odločijo, iz tega dobijo manj; bolj pa so obremenjeni z možnostjo, da bodo s tem nepotrebno obremenili svoje prijatelje in v svoja razmerja prinesli napetost. OXTR gen tem kontrastnim kulturnim normam kljubuje. Za Američane pod stresom, z eno ali večimi kopijami različicami G, obstaja večja verjetnost, da bodo iskali duševno oporo pri prijateljih, kot tisti z dvema kopijama različice A. Za Korejce velja nasprotno – nosilci različice G povečini ne bodo iskali opore v času stiske. Ta specifičen trend je sicer statistično nepomemben, ko ugotovimo, da so v obeh kulturah nosilci različic G bolj občutljivi glede lastnih družbenih norm in da je v bistvu razlika v družbenih normah tista, ki pogojuje različna vedenja. Kot še eno potrditev vpliva okolja, je Kim ugotovila, da se ta vzorec pojavlja zgolj pri ljudeh z veliko stresa. V skupinah z manjšo stresno obremenjenostjo pa je ugotovila, da so Američani sicer bolj nagnjeni k iskanju duševne opore kot Korejci, ampak njihov OXTR gen pri tem ni imel nobenega vpliva.  Seveda med Američani in Korejcine najdemo zgolj kulturno-družbenih razlik, temveč se razlikujejo tudi v genskem zapisu (vključujoč mnoge zapise poleg OXTR). Upoštevajoč to, je Kim preučevala tudi vzorec 32 Američanov, ki so se rodili in odraščali v ZDA, a so bili genetsko Korejci. Ugotovila je, da je bila neposredna povezava med zapisom OXTR in iskanjem duševne opore med temi prostovoljci izrazitejša pri kulturno podobnih Američanih, kot pri genetsko podobnih Korejcih. Richard Ebstein, ki je tudi preučeval in raziskoval OXTR v preteklosti, pravi: »Na splošno se mi zdi to zelo zanimiva ugotovitev... Te študije so potrebne za večje razumevanje, da ni zgolj narava ali zgolj vzgoja tista, ki prispeva k naši prilagojenosti družbenemu okolju, temveč njuno medsebojno prepletanje.« Kljub temu pa ni prepričan, da je Kim preučila dovolj oseb, posebej pri vzorcu Korejcev, ki so se rodili in odraščali v Ameriki. Želel bi, da skušajo ponoviti rezultate na mnogo večji skupini. Kljub temu so rezultati prepričljivi, obenem pa tudi neobičajni, ko iščemo interakcijo med geni in kulturo. Mnoge študije so preučevale sodelovanje narave in vzgoje ampak v večini primerov je vzgoja tista, ki vključuje nekaj družbenega, kar je bodisi kruto bodisi prijazno, npr. nasilno starševstvo. V enem izmed najodmevnejših primerov so ugotovili, da so osebe z nizko aktivno različico MAOA gena bolj nagnjene k agresivnosti od tistih z visoko aktivnim, ampak le, če so bile v otroštvu zlorabljene ali zapostavljene. Kimina študija izstopa na svojem področju, saj se osredotoča na družbene norme in Ebstein pravi, da tako »...ponuja zanimivo, novo smernico za raziskovanje interakcij genov in okolja.« Kim upa, da bo njeno delo opogumilo več znanstvenikov za raziskovanje načinov kako se geni in kultura skupaj razvijata. Poudari, da je različica G OXTR gena pogostejša pri belih Američanih kot Korejcih. Možno je, da je v ameriški kulturi družbena opora prišla do večjega izraza ravno zavoljo genov, ki ljudi nagibajo k določenemu obnašanju. Tako geni omejujejo kulturo, medtem ko kultura zgolj postavlja oder na katerem le-ti izražajo svoj vpliv. Referenca: PNAS http://dx.doi.org/10.1073/pnas.1010830107